From 4619740e6b4c84fd205ae25029ee9bf00e478db1 Mon Sep 17 00:00:00 2001 From: DSchreyer Date: Sat, 6 Jan 2024 10:12:50 +0000 Subject: [PATCH] modules and subworkflows update to 2.11.2 --- modules.json | 40 +-- modules/nf-core/bwa/index/environment.yml | 7 + modules/nf-core/bwa/index/main.nf | 18 +- modules/nf-core/bwa/index/meta.yml | 3 + modules/nf-core/bwa/index/tests/main.nf.test | 33 +++ .../nf-core/bwa/index/tests/main.nf.test.snap | 43 +++ modules/nf-core/bwa/index/tests/tags.yml | 2 + modules/nf-core/cat/fastq/environment.yml | 7 + modules/nf-core/cat/fastq/main.nf | 2 +- modules/nf-core/cat/fastq/meta.yml | 4 +- modules/nf-core/cat/fastq/tests/main.nf.test | 143 +++++++++ .../nf-core/cat/fastq/tests/main.nf.test.snap | 78 +++++ modules/nf-core/cat/fastq/tests/tags.yml | 2 + .../custom/dumpsoftwareversions/main.nf | 6 +- .../dumpsoftwareversions/tests/main.nf.test | 7 +- .../tests/main.nf.test.snap | 50 ++-- modules/nf-core/fastqc/main.nf | 16 +- modules/nf-core/fastqc/tests/main.nf.test | 271 ++++++++++++------ .../nf-core/fastqc/tests/main.nf.test.snap | 12 +- .../nf-core/minimap2/align/environment.yml | 8 + modules/nf-core/minimap2/align/main.nf | 8 +- modules/nf-core/minimap2/align/meta.yml | 10 + .../nf-core/minimap2/align/tests/main.nf.test | 145 ++++++++++ .../minimap2/align/tests/main.nf.test.snap | 38 +++ modules/nf-core/minimap2/align/tests/tags.yml | 2 + modules/nf-core/multiqc/main.nf | 10 +- modules/nf-core/multiqc/meta.yml | 1 - modules/nf-core/multiqc/tests/main.nf.test | 48 +++- .../nf-core/multiqc/tests/main.nf.test.snap | 21 ++ .../picard/markduplicates/environment.yml | 7 + modules/nf-core/picard/markduplicates/main.nf | 10 +- .../nf-core/picard/markduplicates/meta.yml | 4 + .../picard/markduplicates/tests/main.nf.test | 111 +++++++ .../markduplicates/tests/main.nf.test.snap | 44 +++ .../markduplicates/tests/nextflow.config | 6 + .../picard/markduplicates/tests/tags.yml | 2 + .../nf-core/samtools/faidx/environment.yml | 7 + modules/nf-core/samtools/faidx/main.nf | 10 +- modules/nf-core/samtools/faidx/meta.yml | 4 + .../nf-core/samtools/flagstat/environment.yml | 7 + modules/nf-core/samtools/flagstat/main.nf | 17 +- modules/nf-core/samtools/flagstat/meta.yml | 2 + .../samtools/flagstat/tests/main.nf.test | 36 +++ .../samtools/flagstat/tests/main.nf.test.snap | 16 ++ .../nf-core/samtools/flagstat/tests/tags.yml | 2 + .../nf-core/samtools/idxstats/environment.yml | 7 + modules/nf-core/samtools/idxstats/main.nf | 18 +- modules/nf-core/samtools/idxstats/meta.yml | 2 + .../samtools/idxstats/tests/main.nf.test | 36 +++ .../samtools/idxstats/tests/main.nf.test.snap | 16 ++ .../nf-core/samtools/idxstats/tests/tags.yml | 2 + .../nf-core/samtools/index/environment.yml | 7 + modules/nf-core/samtools/index/main.nf | 6 +- modules/nf-core/samtools/index/meta.yml | 4 + .../samtools/index/tests/csi.nextflow.config | 7 + .../nf-core/samtools/index/tests/main.nf.test | 87 ++++++ .../samtools/index/tests/main.nf.test.snap | 28 ++ modules/nf-core/samtools/index/tests/tags.yml | 2 + modules/nf-core/samtools/sort/environment.yml | 7 + modules/nf-core/samtools/sort/main.nf | 8 +- modules/nf-core/samtools/sort/meta.yml | 3 + .../nf-core/samtools/sort/tests/main.nf.test | 73 +++++ .../samtools/sort/tests/main.nf.test.snap | 48 ++++ .../samtools/sort/tests/nextflow.config | 7 + modules/nf-core/samtools/sort/tests/tags.yml | 3 + .../nf-core/samtools/stats/environment.yml | 7 + modules/nf-core/samtools/stats/main.nf | 6 +- modules/nf-core/samtools/stats/meta.yml | 4 + .../nf-core/samtools/stats/tests/main.nf.test | 78 +++++ .../samtools/stats/tests/main.nf.test.snap | 64 +++++ modules/nf-core/samtools/stats/tests/tags.yml | 2 + modules/nf-core/samtools/view/environment.yml | 7 + modules/nf-core/samtools/view/main.nf | 19 +- modules/nf-core/samtools/view/meta.yml | 5 + .../nf-core/samtools/view/tests/bam.config | 3 + .../samtools/view/tests/bam_index.config | 3 + .../nf-core/samtools/view/tests/main.nf.test | 231 +++++++++++++++ .../samtools/view/tests/main.nf.test.snap | 140 +++++++++ modules/nf-core/samtools/view/tests/tags.yml | 2 + modules/nf-core/trimgalore/environment.yml | 7 + modules/nf-core/trimgalore/main.nf | 2 +- modules/nf-core/trimgalore/meta.yml | 4 + modules/nf-core/trimgalore/tests/main.nf.test | 105 +++++++ .../trimgalore/tests/main.nf.test.snap | 148 ++++++++++ modules/nf-core/trimgalore/tests/tags.yml | 2 + .../bam_markduplicates_picard/meta.yml | 8 +- .../tests/main.nf.test | 92 ++++++ .../tests/main.nf.test.snap | 22 ++ .../bam_markduplicates_picard/tests/tags.yml | 2 + .../nf-core/bam_stats_samtools/meta.yml | 4 +- .../bam_stats_samtools/tests/main.nf.test | 102 +++++++ .../tests/main.nf.test.snap | 128 +++++++++ .../nf-core/bam_stats_samtools/tests/tags.yml | 2 + 93 files changed, 2691 insertions(+), 199 deletions(-) create mode 100644 modules/nf-core/bwa/index/environment.yml create mode 100644 modules/nf-core/bwa/index/tests/main.nf.test create mode 100644 modules/nf-core/bwa/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/bwa/index/tests/tags.yml create mode 100644 modules/nf-core/cat/fastq/environment.yml create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test create mode 100644 modules/nf-core/cat/fastq/tests/main.nf.test.snap create mode 100644 modules/nf-core/cat/fastq/tests/tags.yml create mode 100644 modules/nf-core/minimap2/align/environment.yml create mode 100644 modules/nf-core/minimap2/align/tests/main.nf.test create mode 100644 modules/nf-core/minimap2/align/tests/main.nf.test.snap create mode 100644 modules/nf-core/minimap2/align/tests/tags.yml create mode 100644 modules/nf-core/multiqc/tests/main.nf.test.snap create mode 100644 modules/nf-core/picard/markduplicates/environment.yml create mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test create mode 100644 modules/nf-core/picard/markduplicates/tests/main.nf.test.snap create mode 100644 modules/nf-core/picard/markduplicates/tests/nextflow.config create mode 100644 modules/nf-core/picard/markduplicates/tests/tags.yml create mode 100644 modules/nf-core/samtools/faidx/environment.yml create mode 100644 modules/nf-core/samtools/flagstat/environment.yml create mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test create mode 100644 modules/nf-core/samtools/flagstat/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/flagstat/tests/tags.yml create mode 100644 modules/nf-core/samtools/idxstats/environment.yml create mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test create mode 100644 modules/nf-core/samtools/idxstats/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/idxstats/tests/tags.yml create mode 100644 modules/nf-core/samtools/index/environment.yml create mode 100644 modules/nf-core/samtools/index/tests/csi.nextflow.config create mode 100644 modules/nf-core/samtools/index/tests/main.nf.test create mode 100644 modules/nf-core/samtools/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/index/tests/tags.yml create mode 100644 modules/nf-core/samtools/sort/environment.yml create mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test create mode 100644 modules/nf-core/samtools/sort/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/sort/tests/nextflow.config create mode 100644 modules/nf-core/samtools/sort/tests/tags.yml create mode 100644 modules/nf-core/samtools/stats/environment.yml create mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test create mode 100644 modules/nf-core/samtools/stats/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/stats/tests/tags.yml create mode 100644 modules/nf-core/samtools/view/environment.yml create mode 100644 modules/nf-core/samtools/view/tests/bam.config create mode 100644 modules/nf-core/samtools/view/tests/bam_index.config create mode 100644 modules/nf-core/samtools/view/tests/main.nf.test create mode 100644 modules/nf-core/samtools/view/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/view/tests/tags.yml create mode 100644 modules/nf-core/trimgalore/environment.yml create mode 100644 modules/nf-core/trimgalore/tests/main.nf.test create mode 100644 modules/nf-core/trimgalore/tests/main.nf.test.snap create mode 100644 modules/nf-core/trimgalore/tests/tags.yml create mode 100644 subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test create mode 100644 subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap create mode 100644 subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml create mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test create mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap create mode 100644 subworkflows/nf-core/bam_stats_samtools/tests/tags.yml diff --git a/modules.json b/modules.json index 0145244f..8f3be88a 100644 --- a/modules.json +++ b/modules.json @@ -7,77 +7,77 @@ "nf-core": { "bwa/index": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "cat/fastq": { "branch": "master", - "git_sha": "5c460c5a4736974abde2843294f35307ee2b0e5e", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", - "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e", + "git_sha": "37dee863936732fe7e05dc598bf6e183a8e7ef73", "installed_by": ["modules"] }, "fastqc": { "branch": "master", - "git_sha": "65ad3e0b9a4099592e1102e92e10455dc661cf53", + "git_sha": "617777a807a1770f73deb38c80004bac06807eef", "installed_by": ["modules"] }, "minimap2/align": { "branch": "master", - "git_sha": "603ecbd9f45300c9788f197d2a15a005685b4220", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "4ab13872435962dadc239979554d13709e20bf29", + "git_sha": "642a0d8afe373ac45244a7947fb8a6c0a5a312d4", "installed_by": ["modules"] }, "picard/markduplicates": { "branch": "master", - "git_sha": "735e1e04e7e01751d2d6e97055bbdb6f70683cc1", + "git_sha": "20b0918591d4ba20047d7e13e5094bcceba81447", "installed_by": ["bam_markduplicates_picard", "modules"] }, "samtools/faidx": { "branch": "master", - "git_sha": "bf8ff98531167f8245ba5c44ce7d781503ddf936", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["modules"] }, "samtools/flagstat": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", - "installed_by": ["modules", "bam_stats_samtools"] + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "installed_by": ["bam_stats_samtools", "modules"] }, "samtools/idxstats": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", - "installed_by": ["modules", "bam_stats_samtools"] + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "installed_by": ["bam_stats_samtools", "modules"] }, "samtools/index": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_markduplicates_picard", "modules"] }, "samtools/sort": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["modules"] }, "samtools/stats": { "branch": "master", - "git_sha": "735e1e04e7e01751d2d6e97055bbdb6f70683cc1", - "installed_by": ["modules", "bam_stats_samtools"] + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", + "installed_by": ["bam_stats_samtools", "modules"] }, "samtools/view": { "branch": "master", - "git_sha": "3ffae3598260a99e8db3207dead9f73f87f90d1f", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["modules"] }, "trimgalore": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] } } @@ -86,12 +86,12 @@ "nf-core": { "bam_markduplicates_picard": { "branch": "master", - "git_sha": "a9784afdd5dcda23b84e64db75dc591065d64653", + "git_sha": "eeb9d37c6c8b0ab864b8fe68aa6531c5b2beba01", "installed_by": ["subworkflows"] }, "bam_stats_samtools": { "branch": "master", - "git_sha": "735e1e04e7e01751d2d6e97055bbdb6f70683cc1", + "git_sha": "a64788f5ad388f1d2ac5bd5f1f3f8fc81476148c", "installed_by": ["bam_markduplicates_picard", "subworkflows"] } } diff --git a/modules/nf-core/bwa/index/environment.yml b/modules/nf-core/bwa/index/environment.yml new file mode 100644 index 00000000..5d3cb323 --- /dev/null +++ b/modules/nf-core/bwa/index/environment.yml @@ -0,0 +1,7 @@ +name: bwa_index +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::bwa=0.7.17 diff --git a/modules/nf-core/bwa/index/main.nf b/modules/nf-core/bwa/index/main.nf index 8d2e56d9..24b5a2ea 100644 --- a/modules/nf-core/bwa/index/main.nf +++ b/modules/nf-core/bwa/index/main.nf @@ -2,7 +2,7 @@ process BWA_INDEX { tag "$fasta" label 'process_single' - conda "bioconda::bwa=0.7.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/bwa:0.7.17--hed695b0_7' : 'biocontainers/bwa:0.7.17--hed695b0_7' }" @@ -18,13 +18,14 @@ process BWA_INDEX { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${fasta.baseName}" + def args = task.ext.args ?: '' """ mkdir bwa bwa \\ index \\ $args \\ - -p bwa/${fasta.baseName} \\ + -p bwa/${prefix} \\ $fasta cat <<-END_VERSIONS > versions.yml @@ -34,14 +35,15 @@ process BWA_INDEX { """ stub: + def prefix = task.ext.prefix ?: "${fasta.baseName}" """ mkdir bwa - touch bwa/genome.amb - touch bwa/genome.ann - touch bwa/genome.bwt - touch bwa/genome.pac - touch bwa/genome.sa + touch bwa/${prefix}.amb + touch bwa/${prefix}.ann + touch bwa/${prefix}.bwt + touch bwa/${prefix}.pac + touch bwa/${prefix}.sa cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/bwa/index/meta.yml b/modules/nf-core/bwa/index/meta.yml index 2c6cfcd7..730628d0 100644 --- a/modules/nf-core/bwa/index/meta.yml +++ b/modules/nf-core/bwa/index/meta.yml @@ -40,3 +40,6 @@ output: authors: - "@drpatelh" - "@maxulysse" +maintainers: + - "@drpatelh" + - "@maxulysse" diff --git a/modules/nf-core/bwa/index/tests/main.nf.test b/modules/nf-core/bwa/index/tests/main.nf.test new file mode 100644 index 00000000..5fc8d496 --- /dev/null +++ b/modules/nf-core/bwa/index/tests/main.nf.test @@ -0,0 +1,33 @@ +nextflow_process { + + name "Test Process BWA_INDEX" + tag "modules_nfcore" + tag "modules" + tag "bwa" + tag "bwa/index" + script "../main.nf" + process "BWA_INDEX" + + test("BWA index") { + + when { + process { + """ + input[0] = [ + [id: 'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bwa/index/tests/main.nf.test.snap b/modules/nf-core/bwa/index/tests/main.nf.test.snap new file mode 100644 index 00000000..e51ad5bf --- /dev/null +++ b/modules/nf-core/bwa/index/tests/main.nf.test.snap @@ -0,0 +1,43 @@ +{ + "BWA index": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + "genome.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", + "genome.ann:md5,c32e11f6c859f166c7525a9c1d583567", + "genome.bwt:md5,0469c30a1e239dd08f68afe66fde99da", + "genome.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66", + "genome.sa:md5,ab3952cabf026b48cd3eb5bccbb636d1" + ] + ] + ], + "1": [ + "versions.yml:md5,0f20525da90e7489a7ebb02adca3265f" + ], + "index": [ + [ + { + "id": "test" + }, + [ + "genome.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", + "genome.ann:md5,c32e11f6c859f166c7525a9c1d583567", + "genome.bwt:md5,0469c30a1e239dd08f68afe66fde99da", + "genome.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66", + "genome.sa:md5,ab3952cabf026b48cd3eb5bccbb636d1" + ] + ] + ], + "versions": [ + "versions.yml:md5,0f20525da90e7489a7ebb02adca3265f" + ] + } + ], + "timestamp": "2023-10-17T17:20:20.180927714" + } +} \ No newline at end of file diff --git a/modules/nf-core/bwa/index/tests/tags.yml b/modules/nf-core/bwa/index/tests/tags.yml new file mode 100644 index 00000000..28bb483c --- /dev/null +++ b/modules/nf-core/bwa/index/tests/tags.yml @@ -0,0 +1,2 @@ +bwa/index: + - modules/nf-core/bwa/index/** diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml new file mode 100644 index 00000000..bff93add --- /dev/null +++ b/modules/nf-core/cat/fastq/environment.yml @@ -0,0 +1,7 @@ +name: cat_fastq +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::sed=4.7 diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf index 5021e6fc..3d963784 100644 --- a/modules/nf-core/cat/fastq/main.nf +++ b/modules/nf-core/cat/fastq/main.nf @@ -2,7 +2,7 @@ process CAT_FASTQ { tag "$meta.id" label 'process_single' - conda "conda-forge::sed=4.7" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'nf-core/ubuntu:20.04' }" diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml index 8a39e309..db4ac3c7 100644 --- a/modules/nf-core/cat/fastq/meta.yml +++ b/modules/nf-core/cat/fastq/meta.yml @@ -34,7 +34,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test new file mode 100644 index 00000000..f5f94182 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -0,0 +1,143 @@ +nextflow_process { + + name "Test Process CAT_FASTQ" + script "../main.nf" + process "CAT_FASTQ" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/fastq" + + test("test_cat_fastq_single_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_single_end_same_name") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_paired_end_same_name") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_single_end_single_file") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } +} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap new file mode 100644 index 00000000..ec2342e5 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -0,0 +1,78 @@ +{ + "test_cat_fastq_single_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d" + ] + ] + ], + "timestamp": "2023-10-17T23:19:12.990284837" + }, + "test_cat_fastq_single_end_same_name": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66" + ] + ] + ], + "timestamp": "2023-10-17T23:19:31.554568147" + }, + "test_cat_fastq_single_end_single_file": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,e325ef7deb4023447a1f074e285761af" + ] + ] + ], + "timestamp": "2023-10-17T23:19:49.629360033" + }, + "test_cat_fastq_paired_end_same_name": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66", + "test_2.merged.fastq.gz:md5,fe9f266f43a6fc3dcab690a18419a56e" + ] + ] + ] + ], + "timestamp": "2023-10-17T23:19:40.711617539" + }, + "test_cat_fastq_paired_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d", + "test_2.merged.fastq.gz:md5,77c8e966e130d8c6b6ec9be52fcb2bda" + ] + ] + ] + ], + "timestamp": "2023-10-18T07:53:20.923560211" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml new file mode 100644 index 00000000..6ac43614 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/tags.yml @@ -0,0 +1,2 @@ +cat/fastq: + - modules/nf-core/cat/fastq/** diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf index ebc87273..7685b33c 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf @@ -2,10 +2,10 @@ process CUSTOM_DUMPSOFTWAREVERSIONS { label 'process_single' // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.17--pyhdfd78af_0' : + 'biocontainers/multiqc:1.17--pyhdfd78af_0' }" input: path versions diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test index eec1db10..b1e1630b 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test @@ -31,7 +31,12 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out.versions, + file(process.out.mqc_yml[0]).readLines()[0..10], + file(process.out.yml[0]).readLines()[0..7] + ).match() + } ) } } diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap index 4274ed57..29e72446 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap @@ -1,27 +1,33 @@ { "Should run without failures": { "content": [ - { - "0": [ - "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" - ], - "1": [ - "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" - ], - "2": [ - "versions.yml:md5,3843ac526e762117eedf8825b40683df" - ], - "mqc_yml": [ - "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" - ], - "versions": [ - "versions.yml:md5,3843ac526e762117eedf8825b40683df" - ], - "yml": [ - "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" - ] - } + [ + "versions.yml:md5,3843ac526e762117eedf8825b40683df" + ], + [ + "data: \"\\n\\n \\n \\n \\n \\n \\n \\n \\n\\", + " \\n\\n\\n \\n \\n\\", + " \\ \\n\\n\\n\\n \\n \\", + " \\ \\n \\n\\n\\n\\n\\", + " \\n\\n \\n \\n\\", + " \\ \\n\\n\\n\\n\\n\\n \\n\\", + " \\ \\n \\n\\n\\n\\n\\", + " \\n\\n \\n \\n\\" + ], + [ + "CUSTOM_DUMPSOFTWAREVERSIONS:", + " python: 3.12.0", + " yaml: 6.0.1", + "TOOL1:", + " tool1: 0.11.9", + "TOOL2:", + " tool2: '1.9'", + "Workflow:" + ] ], - "timestamp": "2023-11-03T14:43:22.157011" + "timestamp": "2024-01-05T00:18:43.461970077" } -} +} \ No newline at end of file diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index 07d5e433..9e19a74c 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -2,10 +2,10 @@ process FASTQC { tag "$meta.id" label 'process_medium' - conda "bioconda::fastqc=0.11.9" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastqc:0.11.9--0' : - 'biocontainers/fastqc:0.11.9--0' }" + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" input: tuple val(meta), path(reads) @@ -29,11 +29,15 @@ process FASTQC { printf "%s %s\\n" $rename_to | while read old_name new_name; do [ -f "\${new_name}" ] || ln -s \$old_name \$new_name done - fastqc $args --threads $task.cpus $renamed_files + + fastqc \\ + $args \\ + --threads $task.cpus \\ + $renamed_files cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ @@ -45,7 +49,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ } diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index b9e8f926..ad9bc54f 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -3,23 +3,21 @@ nextflow_process { name "Test Process FASTQC" script "../main.nf" process "FASTQC" + tag "modules" tag "modules_nfcore" tag "fastqc" - test("Single-Read") { + test("sarscov2 single-end [fastq]") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = [ - [ id: 'test', single_end:true ], - [ - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) - ] + [ id: 'test', single_end:true ], + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] ] """ } @@ -28,82 +26,195 @@ nextflow_process { then { assertAll ( { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. // looks like this:
Mon 2 Oct 2023
test.gz
// https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - { assert process.out.html.get(0).get(1) ==~ ".*/test_fastqc.html" }, - { assert path(process.out.html.get(0).get(1)).getText().contains("") }, - { assert snapshot(process.out.versions).match("versions") }, - { assert process.out.zip.get(0).get(1) ==~ ".*/test_fastqc.zip" } + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("sarscov2 paired-end [fastq]") { + + when { + process { + """ + input[0] = [ + [id: 'test', single_end: false], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("") }, + { assert path(process.out.html[0][1][1]).text.contains("") }, + + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("sarscov2 interleaved [fastq]") { + + when { + process { + """ + input[0] = [ + [id: 'test', single_end: false], // meta map + file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("sarscov2 paired-end [bam]") { + + when { + process { + """ + input[0] = [ + [id: 'test', single_end: false], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + + { assert snapshot(process.out.versions).match("versions") } ) } } -// TODO -// // -// // Test with paired-end data -// // -// workflow test_fastqc_paired_end { -// input = [ -// [id: 'test', single_end: false], // meta map -// [ -// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) -// ] -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with interleaved data -// // -// workflow test_fastqc_interleaved { -// input = [ -// [id: 'test', single_end: false], // meta map -// file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with bam data -// // -// workflow test_fastqc_bam { -// input = [ -// [id: 'test', single_end: false], // meta map -// file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with multiple samples -// // -// workflow test_fastqc_multiple { -// input = [ -// [id: 'test', single_end: false], // meta map -// [ -// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), -// file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) -// ] -// ] - -// FASTQC ( input ) -// } - -// // -// // Test with custom prefix -// // -// workflow test_fastqc_custom_prefix { -// input = [ -// [ id:'mysample', single_end:true ], // meta map -// file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) -// ] - -// FASTQC ( input ) -// } + + test("sarscov2 multiple [fastq]") { + + when { + process { + """ + input[0] = [ + [id: 'test', single_end: false], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("") }, + { assert path(process.out.html[0][1][1]).text.contains("") }, + { assert path(process.out.html[0][1][2]).text.contains("") }, + { assert path(process.out.html[0][1][3]).text.contains("") }, + + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("sarscov2 custom_prefix") { + + when { + process { + """ + input[0] = [ + [ id:'mysample', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("sarscov2 single-end [fastq] - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id: 'test', single_end:true ], + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.html.collect { file(it[1]).getName() } + + process.out.zip.collect { file(it[1]).getName() } + + process.out.versions ).match() } + ) + } + } + } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 636a32ce..5ef5afbd 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,10 +1,20 @@ { + "sarscov2 single-end [fastq] - stub": { + "content": [ + [ + "test.html", + "test.zip", + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "timestamp": "2023-12-29T02:48:05.126117287" + }, "versions": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], - "timestamp": "2023-10-09T23:40:54+0000" + "timestamp": "2023-12-29T02:46:49.507942667" } } \ No newline at end of file diff --git a/modules/nf-core/minimap2/align/environment.yml b/modules/nf-core/minimap2/align/environment.yml new file mode 100644 index 00000000..de1f3811 --- /dev/null +++ b/modules/nf-core/minimap2/align/environment.yml @@ -0,0 +1,8 @@ +name: minimap2_align +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::minimap2=2.24 + - bioconda::samtools=1.18 diff --git a/modules/nf-core/minimap2/align/main.nf b/modules/nf-core/minimap2/align/main.nf index 4da47c18..47cd420c 100644 --- a/modules/nf-core/minimap2/align/main.nf +++ b/modules/nf-core/minimap2/align/main.nf @@ -3,14 +3,14 @@ process MINIMAP2_ALIGN { label 'process_medium' // Note: the versions here need to match the versions used in the mulled container below and minimap2/index - conda "bioconda::minimap2=2.24 bioconda::samtools=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:1679e915ddb9d6b4abda91880c4b48857d471bd8-0' : - 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:1679e915ddb9d6b4abda91880c4b48857d471bd8-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:365b17b986c1a60c1b82c6066a9345f38317b763-0' : + 'biocontainers/mulled-v2-66534bcbb7031a148b13e2ad42583020b9cd25c4:365b17b986c1a60c1b82c6066a9345f38317b763-0' }" input: tuple val(meta), path(reads) - path reference + tuple val(meta2), path(reference) val bam_format val cigar_paf_format val cigar_bam diff --git a/modules/nf-core/minimap2/align/meta.yml b/modules/nf-core/minimap2/align/meta.yml index 991b39a0..408522d5 100644 --- a/modules/nf-core/minimap2/align/meta.yml +++ b/modules/nf-core/minimap2/align/meta.yml @@ -25,6 +25,11 @@ input: description: | List of input FASTA or FASTQ files of size 1 and 2 for single-end and paired-end data, respectively. + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test_ref'] - reference: type: file description: | @@ -63,3 +68,8 @@ authors: - "@sofstam" - "@sateeshperi" - "@jfy133" +maintainers: + - "@heuermh" + - "@sofstam" + - "@sateeshperi" + - "@jfy133" diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test b/modules/nf-core/minimap2/align/tests/main.nf.test new file mode 100644 index 00000000..b634468b --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/main.nf.test @@ -0,0 +1,145 @@ +nextflow_process { + + name "Test Process MINIMAP2_ALIGN" + script "../main.nf" + process "MINIMAP2_ALIGN" + + tag "modules" + tag "modules_nfcore" + tag "minimap2" + tag "minimap2/align" + + test("sarscov2 - fastq, fasta, true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], fasta, true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, [], true, false, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + [] + ] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, fasta, true, false, false - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = [ + [ id:'test_ref' ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test.snap b/modules/nf-core/minimap2/align/tests/main.nf.test.snap new file mode 100644 index 00000000..a39a1697 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/main.nf.test.snap @@ -0,0 +1,38 @@ +{ + "sarscov2 - fastq, fasta, true, false, false": { + "content": [ + "test.bam", + [ + "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + ] + ], + "timestamp": "2023-12-04T12:07:06.01315354" + }, + "sarscov2 - fastq, fasta, true, false, false - stub": { + "content": [ + "test.bam", + [ + "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + ] + ], + "timestamp": "2023-12-04T12:07:24.487175659" + }, + "sarscov2 - [fastq1, fastq2], fasta, true, false, false": { + "content": [ + "test.bam", + [ + "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + ] + ], + "timestamp": "2023-12-04T12:07:12.50816279" + }, + "sarscov2 - fastq, [], true, false, false": { + "content": [ + "test.bam", + [ + "versions.yml:md5,9e9eeae0002d466d580a9d6e0d003eb1" + ] + ], + "timestamp": "2023-12-04T12:07:18.414974788" + } +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/align/tests/tags.yml b/modules/nf-core/minimap2/align/tests/tags.yml new file mode 100644 index 00000000..39dba374 --- /dev/null +++ b/modules/nf-core/minimap2/align/tests/tags.yml @@ -0,0 +1,2 @@ +minimap2/align: + - "modules/nf-core/minimap2/align/**" diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 1fc387be..70708f33 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -1,10 +1,10 @@ process MULTIQC { label 'process_single' - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.18--pyhdfd78af_0' : + 'biocontainers/multiqc:1.18--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" @@ -25,12 +25,14 @@ process MULTIQC { def args = task.ext.args ?: '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' + def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' """ multiqc \\ --force \\ $args \\ $config \\ $extra_config \\ + $logo \\ . cat <<-END_VERSIONS > versions.yml @@ -41,7 +43,7 @@ process MULTIQC { stub: """ - touch multiqc_data + mkdir multiqc_data touch multiqc_plots touch multiqc_report.html diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index f1aa660e..45a9bc35 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,4 +1,3 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: multiqc description: Aggregate results from bioinformatics analyses across many samples into a single report keywords: diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index c2dad217..d0438eda 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -7,12 +7,9 @@ nextflow_process { tag "modules_nfcore" tag "multiqc" - test("MULTIQC: FASTQC") { + test("sarscov2 single-end [fastqc]") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) @@ -26,20 +23,17 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert path(process.out.report.get(0)).exists() }, - { assert path(process.out.data.get(0)).exists() }, - { assert path(process.out.versions.get(0)).getText().contains("multiqc") } + { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, + { assert process.out.data[0] ==~ ".*/multiqc_data" }, + { assert snapshot(process.out.versions).match("versions") } ) } } - test("MULTIQC: FASTQC and a config file") { + test("sarscov2 single-end [fastqc] [config]") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) @@ -53,9 +47,35 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert path(process.out.report.get(0)).exists() }, - { assert path(process.out.data.get(0)).exists() }, - { assert path(process.out.versions.get(0)).getText().contains("multiqc") } + { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, + { assert process.out.data[0] ==~ ".*/multiqc_data" }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("sarscov2 single-end [fastqc] - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)]) + input[1] = [] + input[2] = [] + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.report.collect { file(it).getName() } + + process.out.data.collect { file(it).getName() } + + process.out.plots.collect { file(it).getName() } + + process.out.versions ).match() } ) } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap new file mode 100644 index 00000000..d087a9df --- /dev/null +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -0,0 +1,21 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,f81e19ab3a8e2b6f2b5d22078117df71" + ] + ], + "timestamp": "2023-12-30T00:26:14.048089591" + }, + "sarscov2 single-end [fastqc] - stub": { + "content": [ + [ + "multiqc_report.html", + "multiqc_data", + "multiqc_plots", + "versions.yml:md5,f81e19ab3a8e2b6f2b5d22078117df71" + ] + ], + "timestamp": "2023-12-30T00:26:52.963964055" + } +} \ No newline at end of file diff --git a/modules/nf-core/picard/markduplicates/environment.yml b/modules/nf-core/picard/markduplicates/environment.yml new file mode 100644 index 00000000..58b795f5 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/environment.yml @@ -0,0 +1,7 @@ +name: picard_markduplicates +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::picard=3.1.1 diff --git a/modules/nf-core/picard/markduplicates/main.nf b/modules/nf-core/picard/markduplicates/main.nf index facd7efb..80930cc4 100644 --- a/modules/nf-core/picard/markduplicates/main.nf +++ b/modules/nf-core/picard/markduplicates/main.nf @@ -2,10 +2,10 @@ process PICARD_MARKDUPLICATES { tag "$meta.id" label 'process_medium' - conda "bioconda::picard=3.0.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' : - 'biocontainers/picard:3.0.0--hdfd78af_1' }" + 'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' : + 'biocontainers/picard:3.1.1--hdfd78af_0' }" input: tuple val(meta), path(bam) @@ -30,6 +30,9 @@ process PICARD_MARKDUPLICATES { } else { avail_mem = (task.memory.mega*0.8).intValue() } + + if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + """ picard \\ -Xmx${avail_mem}M \\ @@ -48,6 +51,7 @@ process PICARD_MARKDUPLICATES { stub: def prefix = task.ext.prefix ?: "${meta.id}" + if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ touch ${prefix}.bam touch ${prefix}.bam.bai diff --git a/modules/nf-core/picard/markduplicates/meta.yml b/modules/nf-core/picard/markduplicates/meta.yml index f7693d2f..1ab90c07 100644 --- a/modules/nf-core/picard/markduplicates/meta.yml +++ b/modules/nf-core/picard/markduplicates/meta.yml @@ -69,3 +69,7 @@ authors: - "@drpatelh" - "@projectoriented" - "@ramprasadn" +maintainers: + - "@drpatelh" + - "@projectoriented" + - "@ramprasadn" diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test new file mode 100644 index 00000000..b2bba094 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test @@ -0,0 +1,111 @@ +nextflow_process { + + name "Test Process PICARD_MARKDUPLICATES" + script "../main.nf" + process "PICARD_MARKDUPLICATES" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "picard" + tag "picard/markduplicates" + + test("sarscov2 - bam, fasta, fai - sorted bam") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions + ).match() } + ) + } + } + + test("sarscov2 - bam, fasta, fai - unsorted bam") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - cram, fasta, fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions + ).match() } + ) + } + } + +} diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap new file mode 100644 index 00000000..cd788a4d --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap @@ -0,0 +1,44 @@ +{ + "sarscov2 - bam, fasta, fai - unsorted bam": { + "content": [ + "test.marked.bam", + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2023-11-28T10:50:37.735339781" + }, + "homo_sapiens - cram, fasta, fai": { + "content": [ + "test.marked.bam", + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2023-11-28T10:50:48.897954543" + }, + "sarscov2 - bam, fasta, fai - sorted bam": { + "content": [ + "test.marked.bam", + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2023-11-28T10:50:26.591387512" + } +} \ No newline at end of file diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config new file mode 100644 index 00000000..02818dd6 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + withName: PICARD_MARKDUPLICATES { + ext.prefix = { "${meta.id}.marked" } + ext.args = '--ASSUME_SORT_ORDER queryname' + } +} diff --git a/modules/nf-core/picard/markduplicates/tests/tags.yml b/modules/nf-core/picard/markduplicates/tests/tags.yml new file mode 100644 index 00000000..4f213d62 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/tags.yml @@ -0,0 +1,2 @@ +picard/markduplicates: + - modules/nf-core/picard/markduplicates/** diff --git a/modules/nf-core/samtools/faidx/environment.yml b/modules/nf-core/samtools/faidx/environment.yml new file mode 100644 index 00000000..01ccbcc7 --- /dev/null +++ b/modules/nf-core/samtools/faidx/environment.yml @@ -0,0 +1,7 @@ +name: samtools_faidx +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/faidx/main.nf b/modules/nf-core/samtools/faidx/main.nf index c1e8ef3a..d3461627 100644 --- a/modules/nf-core/samtools/faidx/main.nf +++ b/modules/nf-core/samtools/faidx/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_FAIDX { tag "$fasta" label 'process_single' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(fasta) @@ -35,8 +35,12 @@ process SAMTOOLS_FAIDX { """ stub: + def match = (task.ext.args =~ /-o(?:utput)?\s(.*)\s?/).findAll() + def fastacmd = match[0] ? "touch ${match[0][1]}" : '' """ + ${fastacmd} touch ${fasta}.fai + cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/faidx/meta.yml b/modules/nf-core/samtools/faidx/meta.yml index 957b25e5..e189af28 100644 --- a/modules/nf-core/samtools/faidx/meta.yml +++ b/modules/nf-core/samtools/faidx/meta.yml @@ -55,3 +55,7 @@ authors: - "@drpatelh" - "@ewels" - "@phue" +maintainers: + - "@drpatelh" + - "@ewels" + - "@phue" diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml new file mode 100644 index 00000000..5efae053 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/environment.yml @@ -0,0 +1,7 @@ +name: samtools_flagstat +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf index eb7e72fc..f1893d7c 100644 --- a/modules/nf-core/samtools/flagstat/main.nf +++ b/modules/nf-core/samtools/flagstat/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_FLAGSTAT { tag "$meta.id" label 'process_single' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(bam), path(bai) @@ -32,4 +32,15 @@ process SAMTOOLS_FLAGSTAT { samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.flagstat + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml index 954225df..97991358 100644 --- a/modules/nf-core/samtools/flagstat/meta.yml +++ b/modules/nf-core/samtools/flagstat/meta.yml @@ -47,3 +47,5 @@ output: pattern: "versions.yml" authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test new file mode 100644 index 00000000..c8dd8dc9 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test @@ -0,0 +1,36 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FLAGSTAT" + script "../main.nf" + process "SAMTOOLS_FLAGSTAT" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/flagstat" + + test("BAM") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.flagstat).match() }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } +} diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap new file mode 100644 index 00000000..880019f2 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap @@ -0,0 +1,16 @@ +{ + "BAM": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ] + ], + "timestamp": "2023-11-14T15:49:22.577133" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/flagstat/tests/tags.yml b/modules/nf-core/samtools/flagstat/tests/tags.yml new file mode 100644 index 00000000..2d2b7255 --- /dev/null +++ b/modules/nf-core/samtools/flagstat/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/flagstat: + - modules/nf-core/samtools/flagstat/** diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml new file mode 100644 index 00000000..2401db0f --- /dev/null +++ b/modules/nf-core/samtools/idxstats/environment.yml @@ -0,0 +1,7 @@ +name: samtools_idxstats +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf index a257d700..00d916bb 100644 --- a/modules/nf-core/samtools/idxstats/main.nf +++ b/modules/nf-core/samtools/idxstats/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_IDXSTATS { tag "$meta.id" label 'process_single' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(bam), path(bai) @@ -33,4 +33,16 @@ process SAMTOOLS_IDXSTATS { samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + touch ${prefix}.idxstats + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ } diff --git a/modules/nf-core/samtools/idxstats/meta.yml b/modules/nf-core/samtools/idxstats/meta.yml index dda87e1e..344e92a3 100644 --- a/modules/nf-core/samtools/idxstats/meta.yml +++ b/modules/nf-core/samtools/idxstats/meta.yml @@ -48,3 +48,5 @@ output: pattern: "versions.yml" authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test new file mode 100644 index 00000000..f6c92150 --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test @@ -0,0 +1,36 @@ +nextflow_process { + + name "Test Process SAMTOOLS_IDXSTATS" + script "../main.nf" + process "SAMTOOLS_IDXSTATS" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/idxstats" + + test("BAM") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.idxstats).match() }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } +} diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap new file mode 100644 index 00000000..4c6c12bd --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap @@ -0,0 +1,16 @@ +{ + "BAM": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ] + ], + "timestamp": "2023-11-14T15:52:19.875194" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/idxstats/tests/tags.yml b/modules/nf-core/samtools/idxstats/tests/tags.yml new file mode 100644 index 00000000..d3057c61 --- /dev/null +++ b/modules/nf-core/samtools/idxstats/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/idxstats: + - modules/nf-core/samtools/idxstats/** diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml new file mode 100644 index 00000000..296ed99e --- /dev/null +++ b/modules/nf-core/samtools/index/environment.yml @@ -0,0 +1,7 @@ +name: samtools_index +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf index 0b20aa4b..8ad18fdc 100644 --- a/modules/nf-core/samtools/index/main.nf +++ b/modules/nf-core/samtools/index/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_INDEX { tag "$meta.id" label 'process_low' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(input) diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml index 8bd2fa6f..01a4ee03 100644 --- a/modules/nf-core/samtools/index/meta.yml +++ b/modules/nf-core/samtools/index/meta.yml @@ -51,3 +51,7 @@ authors: - "@drpatelh" - "@ewels" - "@maxulysse" +maintainers: + - "@drpatelh" + - "@ewels" + - "@maxulysse" diff --git a/modules/nf-core/samtools/index/tests/csi.nextflow.config b/modules/nf-core/samtools/index/tests/csi.nextflow.config new file mode 100644 index 00000000..0ed260ef --- /dev/null +++ b/modules/nf-core/samtools/index/tests/csi.nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_INDEX { + ext.args = '-c' + } + +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test new file mode 100644 index 00000000..c76a9169 --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test @@ -0,0 +1,87 @@ +nextflow_process { + + name "Test Process SAMTOOLS_INDEX" + script "../main.nf" + process "SAMTOOLS_INDEX" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/index" + + test("sarscov2 [BAI]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.bai).match("bai") }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } + + test("homo_sapiens [CRAI]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.crai).match("crai") }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } + + test("homo_sapiens [CSI]") { + + config "./csi.nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert path(process.out.csi.get(0).get(1)).exists() }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap new file mode 100644 index 00000000..b3baee7f --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap @@ -0,0 +1,28 @@ +{ + "crai": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ] + ], + "timestamp": "2023-11-15T15:17:37.30801" + }, + "bai": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ] + ], + "timestamp": "2023-11-15T15:17:30.869234" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml new file mode 100644 index 00000000..e0f58a7a --- /dev/null +++ b/modules/nf-core/samtools/index/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/index: + - modules/nf-core/samtools/index/** diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml new file mode 100644 index 00000000..cd50868c --- /dev/null +++ b/modules/nf-core/samtools/sort/environment.yml @@ -0,0 +1,7 @@ +name: samtools_sort +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf index 1e5181d4..4a666d42 100644 --- a/modules/nf-core/samtools/sort/main.nf +++ b/modules/nf-core/samtools/sort/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_SORT { tag "$meta.id" label 'process_medium' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(bam) @@ -21,13 +21,11 @@ process SAMTOOLS_SORT { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def sort_memory = (task.memory.mega/task.cpus).intValue() if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ samtools sort \\ $args \\ -@ $task.cpus \\ - -m ${sort_memory}M \\ -o ${prefix}.bam \\ -T $prefix \\ $bam diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml index 07328431..2200de72 100644 --- a/modules/nf-core/samtools/sort/meta.yml +++ b/modules/nf-core/samtools/sort/meta.yml @@ -46,3 +46,6 @@ output: authors: - "@drpatelh" - "@ewels" +maintainers: + - "@drpatelh" + - "@ewels" diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test new file mode 100644 index 00000000..abb80978 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test @@ -0,0 +1,73 @@ +nextflow_process { + + name "Test Process SAMTOOLS_SORT" + script "../main.nf" + process "SAMTOOLS_SORT" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/sort" + + test("test_samtools_sort") { + + config "./nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_samtools_sort_stub") { + + config "./nextflow.config" + options "-stub-run" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap new file mode 100644 index 00000000..ff722259 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap @@ -0,0 +1,48 @@ +{ + "test_samtools_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06" + ] + ], + "1": [ + + ], + "2": [ + "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,ea6a0fef94eb534e901f107a05a33a06" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" + ] + } + ], + "timestamp": "2023-12-04T11:11:22.005628301" + }, + "test_samtools_sort_stub": { + "content": [ + "test.sorted.bam", + [ + "versions.yml:md5,33b6a403dc19a0d28e4219ccab0a1d80" + ] + ], + "timestamp": "2023-12-04T17:47:22.314445935" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config new file mode 100644 index 00000000..d0f35086 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + } + +} diff --git a/modules/nf-core/samtools/sort/tests/tags.yml b/modules/nf-core/samtools/sort/tests/tags.yml new file mode 100644 index 00000000..cd63ea20 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/tags.yml @@ -0,0 +1,3 @@ +samtools/sort: + - modules/nf-core/samtools/sort/** + - tests/modules/nf-core/samtools/sort/** diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml new file mode 100644 index 00000000..b89ce647 --- /dev/null +++ b/modules/nf-core/samtools/stats/environment.yml @@ -0,0 +1,7 @@ +name: samtools_stats +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf index 4a2607de..7539140a 100644 --- a/modules/nf-core/samtools/stats/main.nf +++ b/modules/nf-core/samtools/stats/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_STATS { tag "$meta.id" label 'process_single' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(input), path(input_index) diff --git a/modules/nf-core/samtools/stats/meta.yml b/modules/nf-core/samtools/stats/meta.yml index 90e6345f..735ff812 100644 --- a/modules/nf-core/samtools/stats/meta.yml +++ b/modules/nf-core/samtools/stats/meta.yml @@ -57,3 +57,7 @@ authors: - "@drpatelh" - "@FriederikeHanssen" - "@ramprasadn" +maintainers: + - "@drpatelh" + - "@FriederikeHanssen" + - "@ramprasadn" diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test new file mode 100644 index 00000000..20c3efe1 --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/main.nf.test @@ -0,0 +1,78 @@ +nextflow_process { + + name "Test Process SAMTOOLS_STATS" + script "../main.nf" + process "SAMTOOLS_STATS" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/stats" + + test("SAMTOOLS STATS Should run without failures") { + + when { + params { + + outdir = "$outputDir" + } + process { + """ + // define inputs of the process here. + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + + ] + input[1] = [[],[]] + """ + + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + + } + + test("SAMTOOLS CRAM Should run without failures") { + + when { + params { + + outdir = "$outputDir" + } + process { + """ + // define inputs of the process here + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram_crai'], checkIfExists: true) + + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + + + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + + } + + +} diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap new file mode 100644 index 00000000..025c83a5 --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap @@ -0,0 +1,64 @@ +{ + "SAMTOOLS STATS Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def" + ] + ], + "1": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,045a48208b1c6f5b8af4347fe31f4def" + ] + ], + "versions": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ] + } + ], + "timestamp": "2023-12-04T11:07:28.26821485" + }, + "SAMTOOLS CRAM Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43" + ] + ], + "1": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,dfbfa130d4a6925ddd1931dcd8354a43" + ] + ], + "versions": [ + "versions.yml:md5,650a365c6635001436008350ae83337c" + ] + } + ], + "timestamp": "2023-12-04T11:07:50.356233402" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/stats/tests/tags.yml b/modules/nf-core/samtools/stats/tests/tags.yml new file mode 100644 index 00000000..7c28e30f --- /dev/null +++ b/modules/nf-core/samtools/stats/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/stats: + - modules/nf-core/samtools/stats/** diff --git a/modules/nf-core/samtools/view/environment.yml b/modules/nf-core/samtools/view/environment.yml new file mode 100644 index 00000000..99aa69d0 --- /dev/null +++ b/modules/nf-core/samtools/view/environment.yml @@ -0,0 +1,7 @@ +name: samtools_view +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.18 diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf index cb91facf..0b5a2912 100644 --- a/modules/nf-core/samtools/view/main.nf +++ b/modules/nf-core/samtools/view/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_VIEW { tag "$meta.id" label 'process_low' - conda "bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : - 'biocontainers/samtools:1.17--h00cdaf9_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.18--h50ea8bc_1' : + 'biocontainers/samtools:1.18--h50ea8bc_1' }" input: tuple val(meta), path(input), path(index) @@ -53,10 +53,19 @@ process SAMTOOLS_VIEW { """ stub: + def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + def file_type = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt bam") ? "bam" : + args.contains("--output-fmt cram") ? "cram" : + input.getExtension() + if ("$input" == "${prefix}.${file_type}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" + + def index = args.contains("--write-index") ? "touch ${prefix}.csi" : "" + """ - touch ${prefix}.bam - touch ${prefix}.cram + touch ${prefix}.${file_type} + ${index} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/view/meta.yml b/modules/nf-core/samtools/view/meta.yml index 3b05450b..3dadafae 100644 --- a/modules/nf-core/samtools/view/meta.yml +++ b/modules/nf-core/samtools/view/meta.yml @@ -82,3 +82,8 @@ authors: - "@joseespinosa" - "@FriederikeHanssen" - "@priyanka-surana" +maintainers: + - "@drpatelh" + - "@joseespinosa" + - "@FriederikeHanssen" + - "@priyanka-surana" diff --git a/modules/nf-core/samtools/view/tests/bam.config b/modules/nf-core/samtools/view/tests/bam.config new file mode 100644 index 00000000..c10d1081 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/bam.config @@ -0,0 +1,3 @@ +process { + ext.args = "--output-fmt bam" +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/bam_index.config b/modules/nf-core/samtools/view/tests/bam_index.config new file mode 100644 index 00000000..771ae033 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/bam_index.config @@ -0,0 +1,3 @@ +process { + ext.args = "--output-fmt bam --write-index" +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/main.nf.test b/modules/nf-core/samtools/view/tests/main.nf.test new file mode 100644 index 00000000..89ed3555 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/main.nf.test @@ -0,0 +1,231 @@ +nextflow_process { + + name "Test Process SAMTOOLS_VIEW" + script "../main.nf" + process "SAMTOOLS_VIEW" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/view" + + test("sarscov2 - [bam, []], [], []") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true), + [] + ] + input[1] = [[],[]] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + process.out.bai, + process.out.crai, + process.out.csi, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, crai], fasta, []") { + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.cram[0][1]).name, + process.out.bam, + process.out.sam, + process.out.bai, + process.out.crai, + process.out.csi, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, []], fasta, [] - bam output") { + + config "./bam.config" + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + process.out.bai, + process.out.crai, + process.out.csi, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, []], fasta, [] - bam & index output") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + file(process.out.csi[0][1]).name, + process.out.crai, + process.out.bai, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - [cram, []], fasta, qname - bam & index output") { + + config "./bam_index.config" + + when { + process { + """ + input[0] = [ + [ id: 'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + [] + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = Channel.of("testN:2817", "testN:2814").collectFile(name: "readnames.list", newLine: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + file(process.out.csi[0][1]).name, + process.out.crai, + process.out.bai, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [bam, []], [], [] - stub") { + + options "-stub" + config "./bam_index.config" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true), + [] + ] + input[1] = [[],[]] + input[2] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.cram, + process.out.sam, + file(process.out.csi[0][1]).name, + process.out.crai, + process.out.bai, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/view/tests/main.nf.test.snap b/modules/nf-core/samtools/view/tests/main.nf.test.snap new file mode 100644 index 00000000..83427491 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/main.nf.test.snap @@ -0,0 +1,140 @@ +{ + "homo_sapiens - [cram, []], fasta, [] - bam output": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:41:17.563069206" + }, + "sarscov2 - [bam, []], [], []": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:41:03.206994564" + }, + "homo_sapiens - [cram, []], fasta, qname - bam & index output": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + "test.bam.csi", + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:44:39.165289759" + }, + "homo_sapiens - [cram, []], fasta, [] - bam & index output": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + "test.bam.csi", + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:44:32.25731224" + }, + "sarscov2 - [bam, []], [], [] - stub": { + "content": [ + "test.bam", + [ + + ], + [ + + ], + "test.csi", + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:44:45.81037195" + }, + "homo_sapiens - [cram, crai], fasta, []": { + "content": [ + "test.cram", + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,06b9049228b111e7bed5c52fe8a98d9b" + ] + ], + "timestamp": "2023-12-04T17:41:10.730011823" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/view/tests/tags.yml b/modules/nf-core/samtools/view/tests/tags.yml new file mode 100644 index 00000000..4fdf1dd1 --- /dev/null +++ b/modules/nf-core/samtools/view/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/view: + - "modules/nf-core/samtools/view/**" diff --git a/modules/nf-core/trimgalore/environment.yml b/modules/nf-core/trimgalore/environment.yml new file mode 100644 index 00000000..6cd0f51b --- /dev/null +++ b/modules/nf-core/trimgalore/environment.yml @@ -0,0 +1,7 @@ +name: trimgalore +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::trim-galore=0.6.7 diff --git a/modules/nf-core/trimgalore/main.nf b/modules/nf-core/trimgalore/main.nf index dcb77ae7..24ead871 100644 --- a/modules/nf-core/trimgalore/main.nf +++ b/modules/nf-core/trimgalore/main.nf @@ -2,7 +2,7 @@ process TRIMGALORE { tag "$meta.id" label 'process_high' - conda "bioconda::trim-galore=0.6.7" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/trim-galore:0.6.7--hdfd78af_0' : 'biocontainers/trim-galore:0.6.7--hdfd78af_0' }" diff --git a/modules/nf-core/trimgalore/meta.yml b/modules/nf-core/trimgalore/meta.yml index f84c4d77..e649088c 100644 --- a/modules/nf-core/trimgalore/meta.yml +++ b/modules/nf-core/trimgalore/meta.yml @@ -62,3 +62,7 @@ authors: - "@drpatelh" - "@ewels" - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/trimgalore/tests/main.nf.test b/modules/nf-core/trimgalore/tests/main.nf.test new file mode 100644 index 00000000..bc6812cc --- /dev/null +++ b/modules/nf-core/trimgalore/tests/main.nf.test @@ -0,0 +1,105 @@ +nextflow_process { + + name "Test Process TRIMGALORE" + script "../main.nf" + process "TRIMGALORE" + tag "modules" + tag "modules_nfcore" + tag "trimgalore" + + test("test_trimgalore_single_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { report1_lines.each { report1_line -> + { assert path(process.out.log.get(0).get(1)).getText().contains(report1_line) } + } + } + ) + } + } + + test("test_trimgalore_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { report1_lines.each { report1_line -> + { assert path(process.out.log.get(0).get(1).get(0)).getText().contains(report1_line) } + } + }, + { report2_lines.each { report2_line -> + { assert path(process.out.log.get(0).get(1).get(1)).getText().contains(report2_line) } + } + } + ) + } + } +} diff --git a/modules/nf-core/trimgalore/tests/main.nf.test.snap b/modules/nf-core/trimgalore/tests/main.nf.test.snap new file mode 100644 index 00000000..84feacca --- /dev/null +++ b/modules/nf-core/trimgalore/tests/main.nf.test.snap @@ -0,0 +1,148 @@ +{ + "test_trimgalore_single_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test_trimmed.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,a1ab3958205f1ddf48af623242b5b429" + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "html": [ + + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,a1ab3958205f1ddf48af623242b5b429" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test_trimmed.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4" + ] + ], + "unpaired": [ + + ], + "versions": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "zip": [ + + ] + } + ], + "timestamp": "2023-10-17T15:24:57.782141441" + }, + "test_trimgalore_paired_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_val_1.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4", + "test_2_val_2.fq.gz:md5,f3d61189e6d10202da7b8686f1dbb71b" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,315d40465412f9909bbaabf52269274d", + "test_2.fastq.gz_trimming_report.txt:md5,34436303da1c78811103427a2fb57f7b" + ] + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "html": [ + + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,315d40465412f9909bbaabf52269274d", + "test_2.fastq.gz_trimming_report.txt:md5,34436303da1c78811103427a2fb57f7b" + ] + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_val_1.fq.gz:md5,e0a7516b8ea8d6467d6306acb2cd13c4", + "test_2_val_2.fq.gz:md5,f3d61189e6d10202da7b8686f1dbb71b" + ] + ] + ], + "unpaired": [ + + ], + "versions": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "zip": [ + + ] + } + ], + "timestamp": "2023-10-17T15:25:08.513589909" + } +} \ No newline at end of file diff --git a/modules/nf-core/trimgalore/tests/tags.yml b/modules/nf-core/trimgalore/tests/tags.yml new file mode 100644 index 00000000..e9937691 --- /dev/null +++ b/modules/nf-core/trimgalore/tests/tags.yml @@ -0,0 +1,2 @@ +trimgalore: + - modules/nf-core/trimgalore/** diff --git a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml index d5e71609..fe63068e 100644 --- a/subworkflows/nf-core/bam_markduplicates_picard/meta.yml +++ b/subworkflows/nf-core/bam_markduplicates_picard/meta.yml @@ -6,14 +6,13 @@ keywords: - bam - sam - cram - -modules: +components: - picard/markduplicates - samtools/index - samtools/stats - samtools/idxstats - samtools/flagstat - + - bam_stats_samtools input: - ch_bam: description: | @@ -59,3 +58,6 @@ output: authors: - "@dmarron" - "@drpatelh" +maintainers: + - "@dmarron" + - "@drpatelh" diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test new file mode 100644 index 00000000..e721f30c --- /dev/null +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test @@ -0,0 +1,92 @@ +nextflow_workflow { + + name "Test Workflow BAM_MARKDUPLICATES_PICARD" + script "../main.nf" + workflow "BAM_MARKDUPLICATES_PICARD" + + tag "picard" + tag "picard/markduplicates" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "bam_markduplicates_picard" + tag "subworkflows/bam_markduplicates_picard" + tag "subworkflows/bam_stats_samtools" + tag "bam_stats_samtools" + tag "samtools" + tag "samtools/flagstat" + tag "samtools/idxstats" + tag "samtools/index" + tag "samtools/stats" + + test("homo_sapiens - bam") { + + when { + workflow { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + path(workflow.out.bam[0][1]), + path(workflow.out.bai[0][1]), + path(workflow.out.flagstat[0][1]), + path(workflow.out.idxstats[0][1]), + path(workflow.out.stats[0][1]), + ).match("homo_sapiens - bam") }, + { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("97") } + ) + } + } + + test("homo_sapiens - cram") { + + when { + workflow { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + input[2] = [ + [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + path(workflow.out.bam[0][1]), + path(workflow.out.bai[0][1]), + path(workflow.out.flagstat[0][1]), + path(workflow.out.idxstats[0][1]), + path(workflow.out.stats[0][1]), + ).match("homo_sapiens - cram") }, + { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("0.999986") } + ) + } + } + +} diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap new file mode 100644 index 00000000..b1907385 --- /dev/null +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap @@ -0,0 +1,22 @@ +{ + "homo_sapiens - cram": { + "content": [ + "test.bam:md5,6641dc05efa8384a061f378d86d922cd", + "test.bam.bai:md5,c41c60d8a94adebe53b6df80b6e90d38", + "test.flagstat:md5,93b0ef463df947ede1f42ff60396c34d", + "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15", + "test.stats:md5,0035ac8900d85e9a790f4c1f48b76947" + ], + "timestamp": "2023-12-05T17:45:12.484869" + }, + "homo_sapiens - bam": { + "content": [ + "test.bam:md5,3091fe6ba1b7530f382fe40b9fd8f45b", + "test.bam.bai:md5,4d3ae8d013444b55e17aa0149a2ab404", + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783", + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2", + "test.stats:md5,e32e7e49dce1fbe327a89e0fb7bc01b1" + ], + "timestamp": "2023-12-05T17:43:58.582652" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml b/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml new file mode 100644 index 00000000..10b85270 --- /dev/null +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/bam_markduplicates_picard: + - subworkflows/nf-core/bam_markduplicates_picard/** diff --git a/subworkflows/nf-core/bam_stats_samtools/meta.yml b/subworkflows/nf-core/bam_stats_samtools/meta.yml index b05086bc..809bf736 100644 --- a/subworkflows/nf-core/bam_stats_samtools/meta.yml +++ b/subworkflows/nf-core/bam_stats_samtools/meta.yml @@ -7,7 +7,7 @@ keywords: - bam - sam - cram -modules: +components: - samtools/stats - samtools/idxstats - samtools/flagstat @@ -39,3 +39,5 @@ output: Structure: [ path(versions.yml) ] authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test new file mode 100644 index 00000000..97210890 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test @@ -0,0 +1,102 @@ +nextflow_workflow { + + name "Test Workflow BAM_STATS_SAMTOOLS" + script "../main.nf" + workflow "BAM_STATS_SAMTOOLS" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "bam_stats_samtools" + tag "subworkflows/bam_stats_samtools" + tag "samtools" + tag "samtools/flagstat" + tag "samtools/idxstats" + tag "samtools/stats" + + test("test_bam_stats_samtools_single_end") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_single_end_sorted_bam_bai'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") } + ) + } + } + + test("test_bam_stats_samtools_paired_end") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") } + ) + } + } + + test("test_bam_stats_samtools_paired_end_cram") { + + when { + params { + outdir = "$outputDir" + } + workflow { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true) + ] + input[1] = [ [ id:'genome' ], + file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") }, + { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") }, + { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") } + ) + } + } + +} diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap new file mode 100644 index 00000000..d3af1376 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap @@ -0,0 +1,128 @@ +{ + "test_bam_stats_samtools_paired_end_cram_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" + ] + ] + ], + "timestamp": "2023-11-06T09:31:26.194017574" + }, + "test_bam_stats_samtools_paired_end_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,49e2b43344ff92bc4c02463a58f7ba4a" + ] + ] + ], + "timestamp": "2023-12-04T11:07:13.965061942" + }, + "test_bam_stats_samtools_paired_end_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ] + ], + "timestamp": "2023-11-06T09:31:11.668517251" + }, + "test_bam_stats_samtools_single_end_flagstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" + ] + ] + ], + "timestamp": "2023-11-06T09:26:10.340046381" + }, + "test_bam_stats_samtools_paired_end_cram_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" + ] + ] + ], + "timestamp": "2023-11-06T09:31:26.207052003" + }, + "test_bam_stats_samtools_single_end_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,5a6667d97806e5002731e9cf23674fad" + ] + ] + ], + "timestamp": "2023-12-04T11:07:06.676820877" + }, + "test_bam_stats_samtools_paired_end_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ] + ], + "timestamp": "2023-11-06T09:31:11.68246157" + }, + "test_bam_stats_samtools_single_end_idxstats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + ] + ] + ], + "timestamp": "2023-11-06T09:26:10.349439801" + }, + "test_bam_stats_samtools_paired_end_cram_stats": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,2cf2fe93596ee3d74f946097b204a629" + ] + ] + ], + "timestamp": "2023-12-04T11:07:22.30295557" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml new file mode 100644 index 00000000..ec2f2d68 --- /dev/null +++ b/subworkflows/nf-core/bam_stats_samtools/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/bam_stats_samtools: + - subworkflows/nf-core/bam_stats_samtools/**
Process Name \\", + " \\ Software Version
CUSTOM_DUMPSOFTWAREVERSIONSpython3.12.0
yaml6.0.1
TOOL1tool10.11.9
TOOL2tool21.9
WorkflowNextflow
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls
File typeConventional base calls