Skip to content

Commit 5a1aeed

Browse files
gf777gf777
committed
need to beat this test (avoid inward edges)
1 parent b115c6c commit 5a1aeed

File tree

132 files changed

+20
-0
lines changed

Some content is hidden

Large Commits have some content hidden by default. Use the searchbox below for content that may be hidden.

132 files changed

+20
-0
lines changed

‎testFiles/random12.fasta

+2
Original file line numberDiff line numberDiff line change
@@ -0,0 +1,2 @@
1+
>seq1
2+
CAAAAGAGTGACTTTGTAAAAACA

‎testFiles/random12.fastq

+16
Original file line numberDiff line numberDiff line change
@@ -0,0 +1,16 @@
1+
@seq1
2+
CAAAAGAGTGACTTTGTAAAAACA
3+
+
4+
!!!!!!!!!!!!!!!!!!!!!!!!
5+
@seq2 - creates inward edges
6+
CAAAGAGTGACTTTGTAAAAAC
7+
+
8+
!!!!!!!!!!!!!!!!!!!!!!
9+
@seq3 - creates inward edges
10+
AAAAGAGTGACTTTGTAAAAAT
11+
+
12+
!!!!!!!!!!!!!!!!!!!!!!
13+
@seq4 - creates inward edges
14+
CAAAGAGTGACTTTGTAAAAAT
15+
+
16+
!!!!!!!!!!!!!!!!!!!!!!

‎testFiles/random12.kreeq/.index

+2
Original file line numberDiff line numberDiff line change
@@ -0,0 +1,2 @@
1+
21
2+
128

‎testFiles/random12.kreeq/.map.0.bin

6.15 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.1.bin

6.11 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.10.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.100.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.101.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.102.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.103.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.104.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.105.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.106.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.107.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.108.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.109.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.11.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.110.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.111.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.112.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.113.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.114.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.115.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.116.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.117.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.118.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.119.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.12.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.120.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.121.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.122.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.123.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.124.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.125.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.126.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.127.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.13.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.14.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.15.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.16.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.17.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.18.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.19.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.2.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.20.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.21.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.22.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.23.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.24.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.25.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.26.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.27.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.28.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.29.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.3.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.30.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.31.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.32.bin

6.06 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.33.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.34.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.35.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.36.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.37.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.38.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.39.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.4.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.40.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.41.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.42.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.43.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.44.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.45.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.46.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.47.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.48.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.49.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.5.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.50.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.51.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.52.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.53.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.54.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.55.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.56.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.57.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.58.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.59.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.6.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.60.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.61.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.62.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.63.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.64.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.65.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.66.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.67.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.68.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.69.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.7.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.70.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.71.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.72.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.73.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.74.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.75.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.76.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.77.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.78.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.79.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.8.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.80.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.81.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.82.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.83.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.84.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.85.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.86.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.87.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.88.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.89.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.9.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.90.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.91.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.92.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.93.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.94.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.95.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.96.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.97.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.98.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.99.bin

6.01 KB
Binary file not shown.

‎testFiles/random12.kreeq/.map.hc.bin

6.01 KB
Binary file not shown.

0 commit comments

Comments
 (0)